PCRboost® Reagent Kit

Improve Your PCR Performance with PCRboost. Simply.

  • Enhance your most challenging PCR samples
  • Simple to Use
  • Reduces number of cycles
  • Use existing Taq polymerase and PCR protocol

Enhance PCR Performance for Difficult Samples

PCRboost is a unique reagent that enhances end-point and reverse transcription-PCR performance by improving sensitivity and specificity during amplification of genomic DNA or RNA templates. To use, simply replace the water in your PCR with PCRboost. That’s all. It is designed to enhance the amplification of DNA without the need for time consuming optimizations. PCRboost successfully amplifies thermally degraded DNA resulting in a visible amplicon that can be used for downstream applications such as cloning and sequencing.

Successful amplification of thermally degraded DNA using PCRboost

Figure 1: Genomic DNA (gDNA) from human blood was purified using the QIAamp® DNA Blood Mini Kit., and 500ng was exposed to 70°C for 20h. 1 µl (~50ng) of thermally degraded DNA or control DNA stored at 4°C was used as template for PCR reactions. The reactions were set up using 2.5 U Taq DNA polymerase (NEB), 3μl 10x thermopol reaction buffer (NEB), 0.5µl dNTPs (10µM each nucleotide), 0.5µl each of human β-actin forward and reverse primers. The volume in the thermally degraded DNA PCR reaction tubes was brought up either in water or in PCRboost. Following PCR amplification, 10µl of each PCR reaction was run on an agarose gel. A) 500ng human genomic DNA stored at 4°C and thermally degraded at 70°C for 20h run on an agarose gel. L: 1kb ladder. B) 50ng of cold-stored (4°C) and thermally degraded DNA used as template in PCR reactions amplifying the human β-actin gene. PCR reactions were brought up to volume either in water or PCRboost. L: ladder.

Serial Dilution Using PCRboost

Figure-2: 50ng human genomic DNA (gDNA) was amplified by PCR using 2.5 U Taq DNA polymerase (NEB), 3µl 10x thermopol reaction buffer (NEB), 0.5 µl dNTPs (10µM each nucleotide), 0.5 µl each human β-actin forward(5’ctacctcatgaagatcctcacc3’) and β-actin reverse (5’gtacttgcgctcaggaggagc3’;10µM each) in a final volume of 30 µl. The PCRboost volume was serially diluted and replaced by water*. Cycling parameters were: 94°C for 5 min followed by 40 cycles of 94°C for 15 sec, 55°C for 30 sec and 72°C for 30 sec. 10 µl of each PCR reactions was run on a 0.8% agarose/ethidium bromide gel.

Identical Reactions in Water Versus PCRboost

Figure-3:100, 50, 20, 10 or 4 ng gDNA was used in PCR reactions where the reaction was brought up to volume in either water or PCRboost. Samples were used to amplify the fibroblast growth factor 13 (FGF13) gene by PCR using 2.5 U Taq DNA polymerase (NEB), 3µl 10x thermopol reaction buffer (NEB), 0.5 µl dNTPs (10µM each nucleotide), FGF13 forward (5’gaatgttaacaacatgctggc3’) and FGF13 reverse (5’agaagctttaccaatgttttcca3’) (kind gift of Dr. D. Cohn) in a final volume of 30 µl*. Cycling parameters were: 94°C for 5 min followed by 40 cycles of 94°C for 15 sec, 55°C for 30 sec and 72°C for 30 sec. 10 µl of each PCR reaction was run on a 0.8% agarose/ethidium bromide gel.

Comparison of PCRboost to Other PCR Enhancers

Figure-4:PCR enhancers from 3 different companies were tested alongside PCRboost and compared to a non-enhanced water control* using 1 ng gDNA (conditions used were the same as Figure 2 above).

Use of PCRboost with Three Different Taq Polymerases

Figure-5: Taq DNA polymerases from 3 different suppliers were tested alongside PCRboost using 10 ng gDNA* (conditions used were the same as Figure 2 above).

Testing of PCRboost in RT-PCR

Figure-6: RT-PCR reactions were set up using the gene specific reverse primer for the single-copy RNase P gene (5’agaccatcctggctaacacg3’). Small amounts of total RNA (100ng) extracted from 293 cells (human adenocarcinoma cell line) were used for first strand cDNA generation using manufacturer’s instructions for the AffinityScript™ (Stratagene/Agilent Technologies) RT-PCR kit. Reactions were set up using either water or replacing the water component with PCRboost. 1µl of the cDNA was then used in a subsequent second strand PCR reaction using forward (5’ttcactgcttcatgcctacg3’) and reverse primers for the RNase P gene (conditions used were the same in Figure 2 above). Reactions were set up using either water or replacing the water component with PCRboost.

* PCR reactions were set up using cocktails of common elements.



  • Product format: 1 mL
  • Storage time: 6 months
  • Storage temperature: 15 – 25°C
  • Downstream applications: plasmid purification, bacterial propagation, glycerol stock preparation

Click to expand each category & subcategory.

  • Catalog No.: 63301-011
  • Description: PCRboost®
  • Size: 1 mL
  • Price: $250.00
  • Order Here

Yes. PCRboost™ enhances PCR reactions with as little as 10 pg of genomic DNA or 50-100 ng of RNA.

We are currently working on formulations for various downstream applications, including other polymerases. Please refer to our website (https://www.biomatrica.com/) for the latest updates on current and future product information.

PCRboost™ can be used for multiplex PCR and we are currently analyzing its ability to amplify GC-rich templates. Please refer to our website (https://www.biomatrica.com/) for the latest updates.

PCRboost™ does not change the fidelity of polymerases nor does it have an effect on the accuracy of the amplicon sequence. For high fidelity amplification, we recommend the use of a proofreading polymerase.

PCRboost™ has been shown to amplify DNA in presence of PCR inhibitory factors, resulting in 30-50% better amplification.

In case a PCR reaction product containing PCRboost™ needs to be read by UV spectroscopy, it is highly recommended to blank the spectrophotometer against a PCRboost™ sample prior to taking the OD measurements.

You will notice a white pellet (DNA and PCRboost™ components) after ethanol precipitation. Resuspending the pellet in buffer or water redissolves the pellet and does not interfere with performance of the DNA.

No. PCRboost™ does not interfere or inhibit downstream applications, so there is no need to purify the amplified product.

PCRboost™ works with the majority of commercially available Taq polymerases.

It is recommended that PCRboost™ be added to the second-strand RT-PCR reaction. In some cases, however, it may also be advantageous to supplement the first-strand reaction with PCRboost™ instead of water, particularly when attempting to amplify rare transcripts.

PCRboost has a shelf life of 6 months.

No. Simply add PCRboost™ to your PCR cocktail to bring up to volume and run your standard protocol.

Simply substitute PCRboost™ for water to bring your reaction up to volume. For example, if you normally add 20 µl of water per reaction, just add 20 µl of PCRboost™ instead.

Any oligos will work with PCRboost™. Follow your standard PCR reaction protocol and amplification conditions.

PCRboost™ should be stored at room temperature for best performance. Once frozen, a precipitate may form in the liquid, but the function of the PCRboost™ is not affected. Mix thoroughly before use and store at room temperature.

PCRboost™ should be stored at room temperatures between 15°C to 25°C.

5627 Oberlin Drive
Suite 120
San Diego, CA 92121
Tel: 858-550-0308
Fax: 858-678-0597
Email: orders@biomatrica.com